Primer sequences:
1-Beta-Catenin: – left: acagcactccatcgaccag – right: ggtcttccgtctccgatct 2-CyclinD: – left: ttcctgcaatagtgtctcagttg – right: aaagggctgcagctttgtta 3-PCNA: – left: gaactttttcacaaaagccactc – right: gtgtcccatgtcagcaatttt 4-Survivin: – left: gagcagctggctgcctta – right: ggcatgtcactcaggtcca Analysis of liver Pathology Liver samples were collected into PBS and fixed overnight in 40 g/Lparaformaldehyde in PBS at 4°C. Serial 5-μm sections of the right lobes of the livers were stained with hematoxylin and eosin (HE) and were examined histopathologically. Results MSCs culture and identification Isolated and cultured undifferentiated MSCs reached 70-80% confluence at 14 days (Figure 1). In vitro osteogenic and chondrogenic differentiation of MSCs were confirmed by morphological changes and AZD3965 special stains (Figure 2a,b and Figure 3a,b respectively) 4-Hydroxytamoxifen research buy in addition to gene expression of osteonectin and collagen II (Figure 4a&4b) and GADPH (Figure 4c). Figure 1 Undifferentiated mesenchymal stem cells after 2 weeks in culture. (×20) Figure 2 Morphological and histological staining of differentiated BM-MSCs into osteoblasts. (A) (×20) Arrows for differentiated MSCs osteoblasts after addition
of growth factors. (B) (×200) Differentiated MSCs into osteoblasts stained with Alizarin red stain. Figure 3 Morphological and histological staining of differentiated BM-MSCs into chondrocytes. (A) (×20) Arrows for differentiated MSCs chondrocytes after addition of growth factors. (B) (×200) Differentiated MSCs into chondrocytes stained with Alcian blue stain. Figure 4 Agrose gel electrophoresis for Molecular identification of undifferentiated and differentiated BM-MSCs: (A) gene expression of osteonectin (B) gene expression of collagen II and (C) gene expression of GAPDH in undifferentiated and differentiated MSCs. (A&B) Genes expression of osteonectin and collagen II. Lane 1: DNA marker for (100, 200, 300 bp). Lane 2:No
PCR product for osteonectin and Collagen II genes in undifferentiated MSCs. Lane 3: PCR product for osteonectin and Collagen II genes in differentiated MSCs (C) Gene expression of GAPDH. Lane 1: DNA marker (100, 200, 300 bp). Lane 2: PCR product for GAPDH gene in undifferentiated MSCs Histopathology of liver tissues of the animals that received DENA and CCl4 only showed cells with neoplastic changes, anaplastic carcinoma cells, characterized by large cells with eosinophilic cytoplasm, large hyperchromatic nuclei and prominent nucleoli (Figure 5) and macroregenerative selleck kinase inhibitor nodules typeII (borderline nodules) with foci of large and small cell dysplasia (Figure 6).