In contrast hemolysin activity was reduced during sessile growth

In contrast hemolysin activity was reduced during sessile growth indicating that the deletion of secDF may have effects on overall metabolism. SpA seemed to be impaired PRN1371 in reaching its destined subcellular localization. In the

secDF mutant SpA accumulated in the membrane, was reduced in the cell wall fraction but was found in increased amounts in the supernatant. Altered secretion and processing of SpA might be due to impaired cell wall anchoring by the membrane protein sortase. However, Mazmanian et al. have shown that the extracellular enterotoxin B fused to the sorting signal of SpA accumulates in the cytoplasm and to a lesser extent in the membrane in a sortase mutant [48]. Thus, SpA might migrate by an alternate mechanism into the supernatant, circumventing linking to the peptidoglycan. A similar divergent effect on protein secretion

as we observed in the secDF mutant was found in a secG mutant. There SpA was found in increased amounts in the exoproteome, despite unaffected transcription [11]. In contrast, we found deletion of secDF to change mRNA levels for many of the analyzed genes, such as atl, coa, hla, hld and spa. GSK126 concentration The lack of secDF therefore seems to have a different impact on virulence factor expression than secG, influencing, most likely indirectly, transcription in addition to translocation. The absence of SecDF could especially cause a defective or reduced membrane insertion of sensor proteins belonging to one of the numerous S. aureus two component systems MTMR9 contributing to virulence

factor regulation and to adaptations to different growth conditions (reviewed in [49, 50]). The reduced hld levels in the mutant suggests that the secDF deletion affected at least one two component system by impairing signaling via the agr quorum sensor [51]. This study and the work of Sibbald et al. [11] once more demonstrate that protein and mRNA levels do not necessarily correlate. Specific regulation at the protein level has been shown for certain transcription factors in S. aureus [52, 53]. Such a control of protein stability via chaperones and proteases might exist as well for virulence factors. Interestingly, in E. coli, secY, yidC and secD mutants were shown to induce the Cpx system, which up-regulates the expression of factors involved in folding and proteolysis in response to abnormal proteins in the outer membrane, the periplasmic space or the plasma membrane [54]. The induction of similar systems in the S. aureus secDF mutant due to clogging of the membrane, as suggested by the increased amounts of SpA in this compartment, could be an additional factor influencing protein stability and lead to the partially incoherent mRNA and protein levels, as seen for hla, hld and spa during planktonic growth. Conclusions This work provides evidence that although secDF is dispensable in S. aureus, its deletion leads to a pleiotropic phenotype.

CA was measured by fitting a circle equation to the shape of the

CA was measured by fitting a circle equation to the shape of the sessile drop

(due to the sphere-like shape of the drop) and then calculating the slope of the tangent to the drop at the liquid-solid vapor interface line. The camera was positioned in order to observe the droplet under an angle of about 2° to 4° with respect to the plane of the sample surface supporting the droplet. Roll-off angles were measured with a goniometer in order to control the tilt angle. The orthoscopic images were obtained using a commercial photocamera. Results and discussion The samples’ structure was examined by X-ray diffraction, the XRD patterns being presented in Figure 2. Four peaks can be readily indexed to hexagonal wurtzite ZnO (JCPDS file no. 36-1451) corresponding to the Miller indexes of the reflecting planes for selleck ZnO (100), (002), (101), and (102). The strong and sharp diffraction peaks suggest that the as-obtained products are well crystallized. Interestingly, the intensity distribution of some XRD peaks deviates drastically from what is characteristic to standard ZnO where (101) is the strongest XRD line and the intensity ratio [I(002)/I(101)] = 0.56 is the value for non-preferred orientation. For example, in the case of sample b and sample e, the intensity ratio [I(002)/I(101)] increases, its

values larger than 1 being correlated with a high degree of orientation ATM Kinase Inhibitor clinical trial on the c-axis of the ZnO crystallites. The peak at 2θ = 38.3° is assigned to Au (111). With the increase of the reactants’ concentration Pomalidomide and the reaction time, the peak intensity corresponding to gold decreases, suggesting a better covering of the substrate. Figure 2 The XRD patterns of all ZnO samples. The room temperature reflectance and photoluminescence (PL) spectra of the synthesized samples are shown in Figure 3. A strong decrease of reflectance can be noticed at approximately 380 nm in all sample spectra, this being attributed to the band-to-band transition in ZnO. Indeed, the bandgap value was estimated at around 3.27

eV by using the Kubelka-Munk function F(R) = (1 – R)1/2/2R, R being the observed diffuse reflectance. The PL spectra exhibit a strong, broad emission band centered at about 550 nm (2.17 eV) and a weak (or very weak) emission band centered at about 380 nm (3.27 eV). The UV emission has an excitonic origin, being attributed to the recombination of free excitons. Usually, the green emission is linked to some defects, being related to the incorporation of hydroxyl groups in the crystal lattice during the growth process and to the oxygen defects (interstitial ions or vacancies) [36–39]. Due to the fact that when employing wet chemical methods the ZnO crystallites are formed by Zn(OH)2 dehydration, traces of this compound on the ZnO surface lead to the quenching of the ZnO exciton emission [40]. Consequently, we may say that the optical properties of our ZnO samples are typical for this semiconductor.

The chromatograms of BPA 5 mg/L + TiO2 10 mg/L before and after m

The chromatograms of BPA 5 mg/L + TiO2 10 mg/L before and after mixture exposure are shown in Figure 2C, D. This experiment primarily demonstrated that an adsorption relationship between BPA and TiO2-NPs did exist. Adsorption kinetics of BPA on TiO2-NPs Adsorption kinetics was observed for 3 h and the results are presented in Figure 3. The initial concentration of BPA and TiO2-NPs was 5 and 10 mg/L, respectively. The adsorption process of BPA onto TiO2-NPs

was fast. After the adsorption began, the adsorption percentage of BPA on TiO2-NPs increased rapidly and the percentage reached 40% approximately at 5 min. The maximal amount of BPA adsorbed by TiO2-NPs appeared at 30 min, and the value was approximately 70%. The adsorption reached equilibrium basically after 60 min. Figure 3 Adsorption kinetics of BPA on TiO 2 -NPs. The effect of TiO2-NPs alone on zebrafish embryos In this study, significant morphological Selleckchem ATM inhibitor selleck inhibitor abnormalities were not observed in the zebrafish embryos, when exposed to TiO2-NPs suspensions of different concentrations. The 96-h survival rate of the embryos decreased slightly when exposed

to 40 mg/L TiO2-NPs, but there was no significant difference between the treatment and control groups. However, TiO2-NPs were observed to accumulate on the surface of the exposed egg envelopes (Figure 4G, H, J). With increasing concentrations, more TiO2-NPs adhered to and aggregated on the surface of the egg envelopes. When the concentration was increased to 40 mg/L, the egg envelope surface became turbid and difficult to be observed. Figure 4 Effect of TiO 2 -NPs alone and combined toxicological effects of TiO 2 -NPs and BPA on zebrafish embryos. (A-D, I, K) Normal embryonic development of zebrafish. (E, F, I-N) Observed abnormalities (arrows). (G, H, J) TiO2-NPs accumulation (arrows) on the surface of the exposed egg envelopes. Scale bar, 385 μm in (A) to (H) and 1,050 μm

in (I) to (N). Additionally, the hatching rate of the zebrafish embryos was influenced by TiO2-NPs exposure (Figure 5). Compared with treatment groups at lower concentrations and the control group, the hatching rate at 72 hpf of the embryos that were exposed to 40 mg/L of TiO2-NPs was significantly Carnitine palmitoyltransferase II less (p < 0.05). Figure 5 Hatching rate of the zebrafish embryos. *Significant difference compared to other groups (one-way ANOVA, p < 0.05). The combined toxicological effects of TiO2-NPs and BPA on zebrafish embryos: embryo survival, morphological abnormalities, and hatching rate No effect was observed in the zebrafish embryos of the dilution solvent control group (data not shown). No dead embryos were observed in the dilution water control group. There were no significant differences between the BPA alone-exposed and mixture-exposed groups with BPA at 0.5, 1, and 2 mg/L.

coli carrying the control plasmid pCC1 3, is statistically signif

coli carrying the control plasmid pCC1.3, is statistically significant (P < 0.05). These attachment assays were performed in duplicate on at least 3 separate occasions. In addition

to showing that BoaA and BoaB are associated with the OM by protein separation and western blot, we used immunofluorescent labeling of non-permeabilized E. coli cells to demonstrate their display on the bacterial surface. As depicted in Fig 3C, E. coli harboring pSLboaA and pSLboaB are labeled by the α-BoaA and α-BoaB Abs, respectively, while recombinant bacteria selleck compound carrying the control plasmid pCC1.3 are not. Staining of nucleic acids with the fluorescent dye DAPI verified that comparable numbers of bacterial cells were examined (Fig 3C). Quantitative attachment assays revealed that E. coli expressing BoaB attach to HEp2 (laryngeal) and A549 (type II pneumocytes) epithelial cell lines at levels 18- and 68-fold

greater than bacteria carrying pCC1.3, respectively (Fig 3D). In addition, BoaB expression was found to increase adherence to differentiated primary cultures of normal human bronchial epithelium (NHBE). Under the growth conditions used, NHBE cultures form a pseudostratified epithelium with tight junctions containing both ciliated and non-ciliated cells. This epithelium exhibits transepithelial resistance, mucus secretion, mucociliary activity, and an apical surface not submerged in tissue culture medium, thus representing an environment that is similar to the airway lumen in vivo [67–69]. Expression https://www.selleckchem.com/products/cx-4945-silmitasertib.html of the B. Progesterone mallei ATCC23344 BoaA protein on the surface of E. coli also substantially increased adherence to monolayers of A549 and HEp2 cells and to NHBE cultures. Taken together, these data demonstrate that BoaA and BoaB are OM proteins mediating adherence to epithelial cells of the human respiratory tract. B. pseudomallei and B. mallei are facultative intracellular organisms

that can invade, survive and replicate in a variety of eukaryotic cells. Moreover, autotransporter adhesins often specify additional biological functions such as invasion [70], biofilm formation [71], survival within host cells [72] and intracellular motility [16]. For these reasons, we measured the ability of E. coli expressing BoaA and BoaB to invade epithelial cells as well as their ability to survive within murine macrophages. We also measured the ability of these recombinant strains to form biofilms on the plastic support of tissue culture plates using a crystal violet-based assay. The results of these experiments indicated that neither BoaA nor BoaB substantially increase invasion of epithelial cells, phagocytosis of recombinant bacteria by J774A.1 murine macrophages, survival inside these immune cells, or biofilm formation (data not shown).

For subjects

For subjects EPZ5676 aged 65 years and above, the incidence for all fractures was 839/100,000 person-years, for non-spine fractures was 769/100,000 person-years and for hip fracture was 201/100,000 person-years. Other risk factors listed in decreasing order of

impact on fracture risk were: outdoor activity < 60 min/day, BMI < 20 kg/m2, difficulty bending forward, use of walking aid, and age ≥ 65 years (p value < 0.05, Table 2). Although a 10-year increase in age accounted for only a 5.8% increase in 10-year osteoporotic fracture risk, older men aged 65 years or above had a 2.7-fold higher risk of fracture compared with

younger men. Figure 1 shows the fracture risk in different age groups that was adjusted for competing risk of death along the study period. The interaction of age and other risk factors is shown in Fig. 2a. The combination of older age and history of fall was associated with a twofold increase in 10-year fracture risk after adjusting for competing death risk. Men aged 65 years or older with one or more falls per year had a 10-year risk of fracture of 31.9% compared with selleck chemical 15.8% for those younger than 65 years old. Table 2 Clinical risk factors associated with osteoporotic YM155 clinical trial fracture in Hong Kong Southern Chinese men (n = 1,810) Risk factors Subjects (%) B RR (95%

CI) P Age ≥ 65 years 1148 (63.4) 1.0 2.7 (1.2–5.8) 0.013 Age per 10 years increase   0.1 1.1 (1.0–1.1) 0.003 Grip strength <30 kg 447 (24.7) 1.2 3.3 (0.6–17.2) 0.160 History of fall within 1 year 257 (14.2) 2.7 14.5 (6.5–32.3) <0.0001 Difficulty bending forward 185 (10.2) 1.3 3.6 (1.3–9.9) 0.014 Kyphosis 78 (4.3) 1.2 3.4 (0.8–14.8) 0.100 Low back pain 510 (28.2) −0.1 0.9 (0.4–2.2) 0.895 BMI < 20 kg/m2 167 (9.2) 1.3 3.6 (1.0–12.8) 0.050 BMI per unit increase   −0.1 0.9 (0.8–0.9) <0.0001 Walking <30 min/day 167 (9.2) 0.5 1.6 (0.5–5.4) 0.457 History of fragility fracture 576 (31.8) 1.5 4.4 (2.0–9.4) <0.0001 History of clinical or morphometric spine fracture 112 (6.2) −0.3 0.7 (0.1–6.0) 0.761 History of clinical spine fracture 52 (2.9) 0.5 1.6 (0.2–12.0) 0.635 History of parental fracture 65 (3.6) −0.3 0.8 (0.1–5.7) 0.799 Use of walking aid 264 (14.6) 1.0 2.7 (1.1–6.5) 0.030 Homebound 121 (6.7) −0.5 0.6 (0.1–4.5) 0.620 Outdoor activity <60 min/day 608 (33.6) 1.4 4.1 (1.7–9.9) 0.001 Current and ever smoking 673 (37.2) 0.5 1.7 (0.8–3.5) 0.135 Current and ever drinking 43 (2.4) 1.0 2.7 (0.4–20.4) 0.326 Calcium Intake <400 mg/day 185 (10.2) 0.2 1.

J Virol Methods 2008,153(2):214–217 PubMedCrossRef 21 Khunthong

J Virol Methods 2008,153(2):214–217.PubMedCrossRef 21. Khunthong S, Jaroenram W, Arunrut N, Suebsing R, Mungsantisuk I, Kiatpathomchai W: Rapid and sensitive detection of shrimp yellow head virus by loop-mediated isothermal amplification combined with a lateral flow dipstick. J Virol Methods 2013,188(1–2):51–56.PubMedCrossRef 22. Rigano LA, Marano MR, Castagnaro AP, Do Amaral

AM, Vojnov AA: Rapid and sensitive detection of Citrus Bacterial Canker by loop-mediated isothermal amplification combined with simple visual evaluation methods. BMC Microbiol 2010, 10:176.PubMedCentralPubMedCrossRef 23. Duan Y, Zhou L, Hall DG, Li W, Doddapaneni H, Lin H, Liu L, Vahling CM, Gabriel DW, Williams KP, Dickerman A, Sun Y, Gottwald T: Complete genome sequence of citrus huanglongbing bacterium, ‘Candidatus Liberibacter eFT-508 asiaticus’ obtained through metagenomics. Mol Plant Microbe Interact 2009,22(8):1011–1020.PubMedCrossRef

24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol 1990,215(3):403–410.PubMedCrossRef 25. Tindall KR, Kunkel TA: Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase. Biochemistry 1988,27(16):6008–6013.PubMedCrossRef 26. LaBarre P, Hawkins KR, Gerlach J, Wilmoth J, Beddoe A, Singleton J, Boyle D, Weigl B: A simple, inexpensive buy SC79 device for nucleic acid amplification without electricity-toward instrument-free molecular diagnostics in low-resource settings. PLoS One 2011,6(5):e19738.PubMedCentralPubMedCrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions LAR designed the experiments, performed the experimental work and wrote the manuscript; FM performed experimental work and wrote the manuscript, IGO and MPF performed

experiments with DNA from Candidatus Liberibacter americanus. MRM, AMDA and APC contributed to coordinate the study and wrote the manuscript; AAV Fludarabine research buy participated in the analysis and interpretation of the data and wrote the manuscript. All authors read and approved the final manuscript.”
“Background Campylobacter is the leading cause of bacterial zoonotic gastroenteritis in both developing and developed countries [1]. It causes 2 to 7 times more diarrheal cases than Salmonella, Shigella or E. coli O157:H7 [2]. C. jejuni is primarily responsible for human campylobacteriosis. However, the role of C. coli cannot be neglected because many studies from Spain and United Kingdom have emphasized the importance of C. coli because of its multiple antibiotic resistance property and its ability to cause acquired food borne enteric infections [3, 4]. C. coli contribute about 9% of human campylobacteriosis in USA [5] and about 7% in England and Wales [6]. C. coli cases are even higher than C. jejuni in older people [6, 7] and in summer [7]. Pork is considered to be the major reservoir of C. coli[8]. Various studies have reported C. coli as a potential source of human campylobacteriosis.

Determination of multiplicity of infection (MOI) Serial dilutions

Determination of multiplicity of infection (MOI) Serial dilutions of bacteriophage stock solution were mixed with the same amount of A. baumannii cells. After 15 minutes adsorption,

free bacteriophages were removed by centrifugation at 5,000 g for 10 min, pellets were resuspended with LB medium, and samples were taken for bacteriophage titer analysis after 4 hours incubation at 35°C. Adsorption rate, latent period, and phage burst size As described previously [20, 21], 10 mM CaCl2 was added to the infected culture to measure divalent metal ions effects on adsorption rate of phage AB1, samples were taken at different time intervals to analyze the free phage particles in the solutions with and without addition of calcium ions. One-step growth experiment was carried out according to the previous descriptions [45, 46] to determine the latent period GF120918 clinical trial and phage burst size. In brief, 50 ml bacterial cells of A. baumannii KD311 were incubated to mid-exponential-phase (OD600 = 0.4-0.6) and harvested by centrifugation. The pellet was resuspended in 0.5 ml fresh LB medium and mixed with 0.5 ml phage AB1 solution (1 × 108 PFU/ml). Phage AB1 was allowed to adsorb for 1 min and the mixture was subjected to centrifugation immediately

at 13,000 rpm for 30 seconds to remove free phage particles. The pellet was resuspended in 100 ml fresh LB medium and the culture was continuously incubated at 35°C. Samples were taken at 3 min intervals and phage titre was determined by the double-layer-agar plate method. The results were analyzed and the constant phage titer, which represented the many number of infective centres, selleck compound along the latent stage was deduced. The burst size of phage AB1 was calculated by dividing the phage titers at plateau phase

by the number of infective centres. pH stability and thermal stability test pH stability and thermal stability tests were carried out as previously described[47, 48]. Briefly, certain amount of phage particles were treated under specified conditions. Samples were taken at different time intervals and supernatants from centrifugation were used directly in the assays. Initial phage concentration was about 3.5 × 1010 PFU/ml in LB medium. Host range determination 108 bacterial cells were mixed with melted 0.6% agar (50°C) and this mixture was poured on a 2% solid agar to make double layer agar plates. After solidification, we spotted the isolated bacteriophage stock solution on each plate with different bacterium strain and observed whether lysis plaques emerged. The susceptibility test BioMerieux Vitek 32 system (BioMerieux, Inc., USA) was used in clinical samples diagnosis for bacterial identifications and antibiotics susceptibility tests. Acknowledgements The authors thank Dr Jingfu Huang (Tianjin Children Hospital, Tianjin, China) for generously providing the bacterial strains used in this study. This study was supported by a grant (No.

We observed 10 fields per section at 400× magnification, and the

We observed 10 fields per section at 400× magnification, and the mean percentage of positively stained cells was used to determine the expression of the proteins in a section. All counts were performed blindly

for at least 3 randomly chosen sections from each mouse. Statistical analysis Statistical software SPSS 10.0 (Chicago, Illinois) was used in the Protein Tyrosine Kinase inhibitor analysis. A P value less than 0.05 was considered statistically significant. Differences among groups were assessed using the ANOVA test, and the LSD test was used to compare the differences in MMP-9 (protein and mRNA) and PCNA expression among the different groups. Results Combined CoCl2 and glibenclamide treatment influences tumor growth in TA2 mice inoculated with breast cancer cells The average growth rate of tumor in the mice that received combined treatment with CoCl2 + glibenclamide was obviously inhibited compared to the other groups according to the average tumor size that was measured every other day (Figure 1). All the mice were sacrificed 18 days after the initial inoculation and the tumors were removed. The average tumor volume in the CoCl2 + glibenclamide group was significantly reduced when compared with the other groups (Figure 1), and

the differences among these groups had statistical significance (F = 489.5 P = 0.0098). Figure 1 The growth curve of injected TA2 breast cancer cells in the control and treatment groups. Morphologic tumor changes in the treatment and control groups Immediately following sacrifice, breast cancer tissue samples were carefully collected. In the DMSO group, tumor cells invaded see more the surrounding normal tissue. As shown in Figure 2A, there were large areas of necrosis in tumor tissues from the paclitaxel and CoCl2 + glibenclamide groups, while a small amount of necrosis was observed in the DMSO (Figure 2A-a), CoCl2 (Black arrow heads, Figure 2A-b) and glibenclamide groups (Black arrow heads, Figure 2A-c). Moreover, numerous tumor cells in the CoCl2 + glibenclamide group displayed cell degeneration as suggested by the Progesterone presence of vacuoles within the cytoplasm (Black arrow heads, Figure 2A -d). Figure 2 The differences of morphology, MMP9 and

PCNA expression of TA2 breast cancer between the control and treatment groups. A. The morphologic characteristics of TA2 breast cancer in the control and treatment groups (HE staining, ×200). a. DMSO group. b. CoCl2 group. c. Glibenclamide group. d. CoCl2 + glibenclamide group. e. Paclitaxel group. B. Immunohistochemical staining for MMP9 and PCNA in the control and treatment groups (immunohistochemical staining, ×200). a. MMP9 staining of DMSO group. b. MMP9 staining of CoCl2 group. c. MMP9 staining of Glibenclamide group. d. MMP9 staining of CoCl2 + glibenclamide group. e. MMP9 staining of paclitaxel group. f. PCNA staining of DMSO group. g. PCNA staining of CoCl2 group. h. PCNA staining of Glibenclamide group. i. PCNA staining of CoCl2 + glibenclamide group. j.

Samples were

Samples were Anlotinib clinical trial also tested specifically for SIVwrc with a semi-nested PCR with primers specifically designed for the detection of pol regions of SIVs from the western red colobus/olive colobus lineage (SIVwrc S1 [CATGGCAAATGGATTGTACTCA], SIVwrc R2 [GTGCCATTGCTAATGCTGTTTC], SIVwrc S3 [CCAAATTCTTGTTCT ATCCCTAACC], and SIVwrc R3 [AGCAAAAATCATATCAGCAGAAGAT]). These primers were based on SIVwrc and SIVolc sequences published by Courgnaud and colleagues [24]. We used SIVwrc S1 and SIVwrc R2 in the first round PCR,

and SIVwrc S1 and SIVwrc R3 (expected amplicon size approximately 250 bp), and SIVwrc S3 and SIVwrc R2 (expected amplicon size approximately 300 bp) in two parallel semi-nested PCRs. The cycler conditions were 94°C for 5 minutes, 30 × [94°C for 15 seconds, 55°C for 30 seconds, 72°C for 30 seconds], 72°C for 10 minutes, then cooling to 4°C. The PCRs included positive control samples from confirmed SIVwrc positive red colobus monkeys [21]. PCR products were visualised with gel electrophoresis. A subset of samples (n = 4; Loukoum, Leonardo, Lefkas, Tita) was also tested with additional primers targeting SIVwrc/SIVolc/SIVcol in the gag, env and pol regions and primers amplifying gag and env regions of SIVsmm isolated from sooty mangabeys (Table 2). Table 2 Additional PCRs for SIV testing of a subset of samples (n = 4). Primers tested Primer sequences Estimated

amplicon size Region DihydrotestosteroneDHT targeted Reference DR1-DR2/DR4-DR5 DR1 (5′-TRCAYACAGGRGCWGAYGA-3′) 800 Pol [44]   DR2 (5′-AIADRTCATCCATRTAYTG -3′)        

DR4 (5′-GGIATWCCICAYCCDGCAGG-3′) 200       DR5 (5′-GGIGAYCCYTTCCAYCCYTGHGG -3′)       polOR-polis4/polis2uni2 polOR(5′-ACBACYGCNCCTTCHCCTTTC -3′) 800 Pol [10]   polis4(5′-CCAGCNCACAAAGGNATAGGAGG-3′)         polis2(5′-TGGCARATRGAYTGYACNCAYNTRGAA-3′) 650       uni2(5′-CCCCTATTCCTCCCCTTCTTTTAAAA -3′)       wrcpol wrcpolF1 (5′-TAGGGACAGAAAGTATAGTAATHTGG-3′) 1100 Pol [25]   wrcpolR1 (5′-GCCATWGCYAA TGCTGTTTC-3′) GNA12         wrcpolF2 (5′AGAGACAGTAAGGAAGGGAAAGCAGG-3′) 650       wrcpolR2 (5′-GTTCWATTCCTAACCACCAGCADA-3′)       wrcenv wrcenvF1 (5′-TGGC AGTGGGACAAAAATATAAAC-3′) 750 Env [25]   wrcenvR1 (5′-CTGGCAGTCCCTCTTCCA AGTT GT-3′)         wrcenvF2 (5′TGATAGGGMTGGCTCCTGGTGATG3′) 550       wrcenvR2 (5′-AATCCCCATTTYAACCAGTTCCA-3′)       wrcgag wrcgagF1 (5′-ATDGAGGATAGAGGNTTTGGAGC-3′) 600 Gag [46]   wrcgagR1 (5′-GCCCTCCTACTCCTTGACATGC-3′)         wrcgagF2 (5′-CCAACAGGGTCAGATATAGCAG-3′) 250       wrcgagR2 (5′-ACTTCTGGGGCTCCTTGTTCTGCTC-3′)       olcpol olcpolF1(5-TAGATACAGGRGCAGATGAYACAGTAAT-3′) 700 Pol S. Locatelli, unpublished data   olcpolR1 (5′TCCAYCCYTGAGGHARYACATTATA-3′)         olcpolF2 (5′-CTAGAATWATWGGRGGRATAGGRGG-3′) 300       olcpolR2 (5′-ATYTTWCCTTCTKCTTCYARTCTRTCACA-3′)       bwcpol bwcpolF1 (5′-TAGATACAGGAGCAGATGATACAGT-3′) 1000 pol S.

2004; Loll et al 2005; Guskov et al 2009; Umena et al 2011) M

2004; Loll et al. 2005; Guskov et al. 2009; Umena et al. 2011). Most work on the structure and function CYT387 of CyanoQ has come from studies of the mesophilic cyanobacterium Synechocystis sp. PCC 6803, hereafter Synechocystis, where it is known to be a subunit of oxygen-evolving PSII complexes (Roose et al. 2007). Synechocystis cells lacking CyanoQ grow photoautotrophically as well as WT under optimal growth conditions but do show some growth inhibition when exposed to nutrient stress such as by depleting the medium of calcium and chloride (Thornton et al. 2004) and iron (Summerfield et al. 2005). Analysis of isolated PSII

complexes lacking CyanoQ from Synechocystis suggests that CyanoQ stabilises binding of PsbV and helps protect the oxygen-evolving Mn4CaO5 complex from reduction in the dark (Kashino et al. 2006). The crystal structure of Escherichia coli-expressed Synechocystis CyanoQ, determined to

a resolution of 1.8 Å, is similar to that of PsbQ from spinach with a root mean selleck chemicals llc square deviation (RMSD) for the Cα atoms of 1.4 Å despite only 17 % identity in primary structure (Jackson et al. 2010). Both crystallised proteins consist of a four-helix bundle and contain bound Zn2+, although a metal-free structure has also been determined for Synechocystis CyanoQ

(Jackson et al. 2010); the physiological relevance of these metal-binding sites is currently unknown. In contrast, much less is known about CyanoQ in the thermophilic cyanobacteria used for structural studies of PSII. Indeed the association of CyanoQ with PSII in either T. elongatus or T. vulcanus has yet to be demonstrated. Here, we describe the crystal structure of E. coli-expressed CyanoQ from T. elongatus and provide evidence that CyanoQ co-purifies with isolated PSII and strikingly is still present in samples used to generate PSII crystals lacking CyanoQ. Materials and methods Thermosynechococcus elongatus BP1 strains A His-tagged CP43 Tideglusib strain (CP43-His) of Thermosynechococcus elongatus (Sugiura and Inoue 1999) was kindly provided by Dr Miwa Sugiura, and a His6-tagged derivative of CP47 (CP47-His) by Dr Diana Kirilovsky. The WT strain was the same as that used by Ferreira et al. (2004). Construction of plasmid for over-expression of CyanoQ The DNA sequence corresponding to the CyanoQ homologue of T. elongatus (tll2057) without the sequence encoding the predicted signal peptide and lipid-binding Cys24 residue was cloned into a pRSET-A vector modified as described in Bialek et al. (2013). The corresponding PCR fragment was amplified from T.