2C). Recurrence rates at 1 and 5 years were 20% and 75%, respectively, for the cirrhosis subgroup. The overall rate of recurrence was significantly higher in the cirrhosis subgroup compared with the no cirrhosis subgroup (Table 2). The only variable associated

with survival on univariate analysis MAPK Inhibitor Library in the cirrhosis population was platelet count. Both a cutoff of 100,000/μL (P = 0.046) and a cutoff of 150,000/μL (P = 0.039) were significantly associated with survival (Table 5). The only variables significantly associated with time to recurrence on univariate analysis among these patients with cirrhosis were performing a nonanatomic resection (P = 0.017) and the presence of satellites (P = 0.035) (Table 5). Multivariate analysis was not conducted in this subgroup. Patients with no vascular invasion and no satellites (BCLC 0/Japanese selleck compound T1) on pathology were selected as “true” cases of very early HCC (n = 85). These patients had median and 5-year survivals of 138 months and 76% compared with 65.1 months and 57% (P = 0.137) for those with vascular invasion and/or satellites. Recurrence rates at 1 and

5 years were 12% and 61%, respectively, for this subgroup (Fig. 2D). Recurrence at 1 year was significantly lower for patients with very early tumors and the difference was just at the cutoff for significance for overall recurrence. The only variable significantly associated with survival on univariate analysis in this subgroup of patients was platelet count <150,000/μL (P = 0.011) and the only variable associated with recurrence was cirrhosis (stage Amino acid 4 fibrosis) (P = 0.012) (Table 5). Again, multivariate analyses were not performed. Performing an anatomic resection in these patients with no vascular invasion and no satellites did not result in lower early or overall recurrence. However, for the remaining 47 patients with either vascular invasion or satellites, performing an anatomic resection was associated with a significant reduction in recurrence at 1 year from

50% down to 11% (P = 0.008). Although there was a clear trend toward better overall survival as well as lower overall recurrence with anatomic resection in these 47 patients with either vascular invasion or satellites, the P values did not reach significance. There were 16 (12%) patients who were found to have satellites on pathology. The presence of satellites was not recognized preoperatively in any of the cases. As demonstrated in Tables 2 and 3, the presence of satellites was an independent predictor of survival, overall recurrence, and early recurrence at 1 year. By coincidence, half (n = of the patients with satellites underwent anatomic liver resections, whereas the other half did not. Despite the very small sample size, anatomic resection was associated with significantly better survival, lower overall recurrence, and lower early recurrence at 1 year in these patients (Figs. 2E,F).

The reasons for this difference are likely the small number of dually infected subjects Small molecule library in their study and differences in the patient characteristics. In our study, most of the dually infected patients had lower serum HBV loads because HBV is usually acquired perinatally or in early infancy and is inhibited by a subsequent HCV superinfection.2-4 Further investigation will be required to elucidate the contribution of steatosis to fibrogenesis in patients with HBV-HCV dual infection. Chao-Hung Hung M.D.*, Chuan-Mo Lee M.D.*, Sheng-Nan Lu M.D., M.P.H., Ph.D.*, Jing-Houng Wang M.D.*, Chien-Hung Chen M.D., Ph.D.*, Tsung-Hui Hu M.D., Ph.D.*,

* Division of Hepatogastroenterology, Department of PD-1 inhibitor Internal Medicine, Chang Gung Memorial Hospital–Kaohsiung Medical Center, Chang Gung University College of Medicine, Kaohsiung, Taiwan. “
“We investigated the patency rate of a biliary stent and the effects of ursodeoxycholic acid (UDCA) therapy and endoscopic sphincterotomy (EST) for difficult-to-remove common bile duct stones. A total of 63 endoscopic retrograde cholangiopancreatographies (ERCPs) were performed in 36 patients (mean age, 86.0 years; male–female, 17:19) for stenting. Among the 63 subjects, 28 were further treated with EST; 20, with UDCA therapy; and 43, without UDCA therapy. The mean patency time was significantly

longer in the UDCA treatment group (1,012 days) than in the “stent without UDCA” group (354 days; P = 0.0002; hazard ratio, 0.253). The mean patency time was significantly longer in the patients who had stent placement with EST (1074 days) than in those who had stent placement without EST (279 days; P = 0.001; hazard ratio, 0.439). The mean patency time was significantly longer in the patients who had stent placement with UDCA therapy Urease and EST (1211 days) than in the patients who had stent placement with either UDCA therapy or EST (425 days; P = 0.031; hazard ratio, 0.3292). The mean patency time was significantly longer in the

patients who had stent placement with either UDCA therapy or EST than in those who had stent placement without UDCA therapy or EST (263 days; P = 0.0465; hazard ratio, 0.5124). Biliary stenting combined with UDCA therapy and EST may be considered as an effective treatment method for cases of common bile duct stones in elderly patients that are difficult to remove. “
“Patients who develop extrapyramidal symptoms on a background of cirrhosis and portosystemic shunting (PSS) form a unique subset of so-called acquired hepatocerebral degeneration.[1] The syndrome is different from other forms of Parkinsonism that develop in patients without liver disease and rarely responds to standard treatments for hepatic encephalopathy (HE). Rifaximin is a nonabsorbable antibiotic which has recently been shown to be efficacious in the secondary prevention of recurrent HE.

Because antibodies to CagA remain positive longer than H. pylori IgG surface antibodies, relying on H. pylori IgG antibodies alone might misclassify a significant proportion of patients who once had the infection [10]. In our study population,

the frequency of active and past infection with strains carrying CagA was very high—more than 70%. The results of other studies in Mexican population are consistent with ours [5, 40]. Longitudinal studies are required to understand the meaning of high prevalence of the virulence factor in these populations. Most of the epidemiological studies in adults have found an association between peptic AUY-922 concentration ulcers and gastric cancer, with H. pylori carrying CagA-positive strains [39, 41]. However, other factors may affect these associations. A study was carried out in two villages of the same country with high prevalence of CagA-positive strain but different gastric cancer risks. The study demonstrated that in subjects with CagA-positive and vacA s1 m1 strains, the ancestral origin of H. pylori strains was a strong predictor for gastric cancer risk. The European but not the African phylogeographic origin of the H. pylori strains was strongly associated with more advanced histological lesions and increased Selleck BMS-777607 DNA damage in gastric epithelial

cells [3]. Another study concluded that iron depletion, in conjunction with the presence of H. pylori CagA-positive strains, should be considered a risk factor for the progression of gastric cancer because iron deficiency enhances H. pylori virulence and could represent a measurable biomarker to identify infected populations at higher risk for gastric cancer [11]. Clinically, the UBT is useful to monitor the eradication of bacteria after receiving therapy because this test identified active infection. At the public health level, serological tests give a more complete representation of the percentage of individuals who have been exposed to H. pylori infection and of the prevalence of virulence factors. If the prevalence of H. pylori infection obtained using serological tests is compared to the prevalence by UBT, serological tests overestimate the prevalence

of H. pylori up to 30%. But serological tests based on immunoglobin G antibodies underestimate the percentage of infection that corresponds to active and acute infection in subjects Beta adrenergic receptor kinase without detectable immune response to H. pylori whole-cell or Cag A-specific antigens but with positive UBT. In this study the percentage of underestimation was 4.9%. The results of our study confirm the association between factors related to low socioeconomic level and poor health conditions as iron deficiency and low height for age with H. pylori infection [4, 9, 21, 23], even in this low-income homogeneous population. H. pylori infection has been associated with ID or IDA in children in multiple studies. In clinical trials, higher response to iron supplementation has been observed with H.

PCR-based detection of HP0986 was performed on all H. pylori strains using gene-specific primers as described elsewhere [14]. Helicobacter pylori cultures (n = 110) were pelleted

and washed twice with 1X phosphate buffer saline and further pelleted by centrifugation at 4000 rpm for 5 minutes RNA was extracted from each pellet using Qiagen RNeasy Mini Kit as per the manufacturer’s instructions and treated with DNase I (Qiagen, Hilden, Germany) on columns and further purified by RNA clean up. In a similar way, total RNA from each of the 10 frozen biopsies were Enzalutamide mouse also extracted. RNA samples were quantitated by Nanodrop spectrophotometer and stored at −80°C until further use. Expression analysis was carried out by IQ5 real-time PCR (BioRad Laboratories, Hercules, CA, USA). Briefly, the reaction was performed in 25 μL volume containing 12.5 μL of SYBR green (iScript™One-Step RT-PCR kit, Qiagen), 1.25 μL of forward primer GAAAAGAGTTTA GAAAAGATACA, 1.25 μL of reverse primer CTTGAT GGTCTTTGTAAAACA, 0.25 μL of reverse transcriptase (Qiagen), 1 μL of RNA template, and 8.75 μL of Dnase/RNase free water. PCR conditions for both HP0986 and 16S RNA (control) were denaturation at 94°C for 15 minutes; 40

cycles of 94°C for 15 seconds; annealing at 45°C for 30 seconds, extension at 72°C for 30 seconds followed by 61 cycles Dorsomorphin of melting curve analysis at 65°C for 10 seconds. Reaction without RNA template was included as negative control for each primer tested and a control without reverse transcriptase was also included for each test. The analysis was performed in triplicates and IQ5 real-time PCR software (Biorad) was used to generate the quality control of the replicates, data extraction and initial analysis. Data were analyzed by ∆∆CT method as described earlier

[23]. Relative expression level of HP0986 normalized to the 16SrRNA was checked in clinical isolates and in gastric biopsies when compared with the Vasopressin Receptor levels of HP0986 mRNA in strain P12. Also, HP0986 specific amplification was confirmed by a single amplicon on 1% agarose gel. The ORF/gene hp0986 was cloned in prokaryotic expression vector pRSETA and was purified to homogeneity as described earlier [21]. To clone hp0986 into eukaryotic expression vector, the gene was amplified from the genomic DNA of H. pylori strain 26,695 using the following primers: 5′CCCCTCGAGATGGTGGAACT TTTTTCTCTTTGCATGTC 3′ (xho I), 5′AATAAGCTTACG CCTAGAGTTATTAATATAATTCTCAATATTTT 3′ (Hind III). The amplified 714 bp product and TA cloning vector (Fermantas, Lafayette, CO, USA) were incubated together for an overnight ligation at 16°C. Insert was confirmed by double restriction digestion (Hind III, xho I) and was further subcloned into pEGFPN-1 (Clonetech) vector. The clone was again confirmed for the insert by double restriction digestion and sequencing. AGS cells were obtained from the National Center for Cell Sciences, (Pune, India).

The long-term goal for Src inhibitor haemophilia treaters would be to have prospective predictors of inhibitor formation or avoidance; prospective predictors of immune tolerance induction

(ITI), success or failure, and to identify interventions for high-risk patients. This section briefly summarizes the background rationale for the satellite RNA sequencing (RNA seq) scientific substudy in the forthcoming NuProtect trial and how this technology may contribute to future understanding of inhibitor formation and tolerization mechanisms. There has been rapid progress in the field of genomics in the last 60 years. In 1986, the human genome project began and in 2001 the initial human genome sequence was published [10], 2 years earlier than predicted and less than 50 years since the basic structure of DNA was described [11]. Further rapid technological advance, most noteably that of next-generation sequencing (NGS), makes high throughput sequencing accessible and affordable. NGS enables genome-wide, RNA seq offering the chance to apply this exciting technology in key studies. RNA seq captures dynamic gene expression, that is which genes are actually being used or suppressed at the point of sampling. A genome-wide assessment of gene use (transcriptome Tanespimycin chemical structure analysis) will provide a snapshot of the environment of FVIII concentrate exposure in PUPs, combining genetic data reflecting both environmental factors

(inflammation, infection) and inherited genetic polymorphisms. RNA seq will be carried out in the NuProtect trial as a satellite scientific study. It will be the first study in PUPs utilizing this technology. Such a study will create a large and valuable data set for future MycoClean Mycoplasma Removal Kit research. It will be hypothesis generating, given the unselected, genome-wide recording of RNA expression data. In PUPs, 1 mL of additional blood for sequencing will be taken at baseline and every 3–4 exposure days with

routine inhibitor screening until 20 exposure days. RNA studies have been used in vaccine research to understand the mechanisms by which vaccines stimulate protective immunity. Data have enabled prediction of the immunogenicity or efficacy of vaccines and the technique has already defined predictive signatures of human antibody responses to influenza vaccination. A study by Bucasas et al. [12] investigated the correlation of gene expression patterns and antibody response to influenza vaccination in a cohort of healthy male adults. The study showed that marked-up regulation of expression of genes involved in interferon signalling, positive IL-6 regulation and antigen processing and presentation were detected early, within 24 h of vaccination. Later RNA signatures involved cellular proliferation, protein metabolism and antiapoptosis pathways. The authors concluded that high vaccine responder status correlates with increased early expression of interferon signalling and antigen processing and presentation genes.

” The creatures outside looked from pig to

man, and from man to pig, and from pig to man again: but already it was impossible to say which was which. George Orwell: Animal Farm (1945) A potential treatment for haemophilia GPCR Compound Library was first identified in 1937 when a component of human plasma called ‘antihaemophilic globulin’ was described [1]. Although blood transfusion was routine at that time, the separation of plasma from donated whole blood on the large scale required to permit commercial fractionation only became a reality in the 1970s. Biggs, Macfarlane and Bidwell in Oxford estimated that every haemophilic patient would need the plasma from 1000 donors each year for the production of enough material for maintenance treatment. In recognition of the fact that this was ‘wildly impractical’, the group pursued the development of antihaemophilic globulin derived from animals as a potential treatment [2]. The first material purified was bovine factor VIII, extracted from plasma collected from animals sent to an abattoir for slaughter [3,4]. Approximately 3–4 L were obtained from each animal and the globulin

was purified by fractionation in the presence of potassium phosphate and sodium citrate. Early reports were encouraging, but it soon became apparent that repeated treatment with LBH589 mouse this product was frequently complicated by severe allergic reactions and thrombocytopenia. Furthermore, patients also soon became refractory to the product, a phenomenon which was attributed to the development of alloantibodies against the bovine factor VIII protein. Porcine plasma was first used to treat a patient in 1954. The first recipient was a 22-year-old man from Norwich, who worked in a gun shop and who got shot in the loin by mistake by a customer who was trying out a rifle [2,5a]. He required surgery and was initially treated with bovine material. This was initially successful in controlling the bleeding, but soon the patient developed severe allergic reactions and the bleeding was no

longer controlled owing to the appearance of inhibitory antibodies against the bovine material. In some desperation, porcine plasma was obtained from an abattoir in the neighbouring Norfolk village on a Sunday. By Wednesday of the following week, the Oxford group had prepared an extract of porcine antihaemophilic globulin, which saved this young man’s life. Porcine antihaemophilic Ureohydrolase globulin turned out to be generally better tolerated than bovine material, although allergic reactions and resistance caused by antibody formation were still a problem after repeated infusions. A lyophilized concentrate of porcine antihaemophilic globulin was subsequently manufactured by S. Maw and Sons Ltd of north London [Fig. 1] and remained in use in the late 1950s and early 1960s. It must be emphasized that porcine and bovine preparations were initially used to treat all patients with haemophilia A, and not just those who had developed inhibitors to factor VIII.

The significance of trypsinogen degradation in protecting the pancreas against pancreatitis is also underscored by the protective effect of the p.G191R anionic trypsinogen (PRSS2) variant, which undergoes trypsin-induced degradation.23 The physiological role of CTRC in promoting activation of proCPA1 and proCPA2

raises the possibility that loss of CTRC function increases pancreatitis risk through impaired check details carboxypeptidase activation.64 This model would predict that loss-of-function mutations in the CPA1 or CPA2 genes should be also risk factors for chronic pancreatitis. Surprisingly, this seems to be the case, as newer, yet unpublished studies indicate click here that CPA1 is a susceptibility gene for chronic pancreatitis, and loss of CPA1 function increases disease risk (Dr Heiko Witt, pers. comm., 2011). However, the mechanism through which reduced carboxypeptidase activity would promote pancreatitis development is not readily apparent yet. The p.A73T mutation increases the propensity of CTRC to elicit ER stress, possibly through mutation-induced misfolding.68 ER stress-induced apoptosis can accelerate the loss of functional acini and contribute

to exocrine insufficiency, a hallmark of chronic pancreatitis. These effects of the p.A73T mutant can be considered as gain of function, because the mutant CTRC protein triggers cellular signal transduction processes that result in acinar cell damage and increased risk of chronic pancreatitis. There are two caveats to this attractive model. First, more research is needed to clarify whether all

disease-associated CTRC mutants can elicit ER stress, or whether this is a unique property of the p.A73T mutant. Second, it remains unclear whether CTRC expression levels in the human pancreas Non-specific serine/threonine protein kinase are high enough for mutant CTRC proteins to induce ER stress. Nevertheless, ER stress emerges as a potentially new paradigm for the mechanism of genetic risk in chronic pancreatitis.70 The three mechanistic models described earlier reflect our current, rapidly-expanding understanding of CTRC function and mutational effects. The wealth of new information in this respect is a testimony to one of the fundamental benefits of human genetics: the stimulation of investigations into novel physiological functions and pathological pathways. The authors are grateful to Dr Jonas Rosendahl and Dr Sebastian Beer for critical reading of the manuscript. Studies in the senior author’s laboratory were supported by NIH grants R01 DK058088 and R01 DK082412 and ARRA grant R01 DK082412-S2. “
“Introduction: Currently empirical criteria are used to determine usability of donor livers however they have a low predictive value and alternative methods to determine viability are desirable.

Of those, 115 LdT and 117 TDF patients were included in the mITT population. Baseline characteristics were well matched between the treatment groups. The primary efficacy endpoint for non-inferiority was met, with 92.1% LdT and 95% TDF patients achieving HBV DNA level <300 copies/ mL at Week 52 (Table). There were

no deaths. Serious adverse events (SAEs), reported in 17 patients (8 in Akt inhibitor LdT and 9 in TDF), were not related to the treatment according to investigator’s opinion. Twice as many patients from the LdT monotherapy arm with an abnormal estimated glomerular filtration rate (eGFR) at baseline reverted to normal eGFR compared to the TDF mono-therapy arm. Conclusions: LdT is effective and non-inferior to TDF for the treatment of HBeAg-negative CHB. LdT was associated with an improvement in renal function (eGFR) when compared to TDF. Table. Efficacy and safety outcomes

Disclosures: Zahary Krastev – Grant/Research Support: Gilead Sciences INC, Gilead DNA Methyltransferas inhibitor Sciences INC, Gilead Sciences INC, Gilead Sciences INC, novartis David Mc Neeley – Employment: Novartis Pharmaceutical Corporation; Stock Shareholder: Novartis Pharmaceutical Corporation Kamal A. Hamed – Employment: Novartis; Stock Shareholder: Novartis The following people have nothing to disclose: Iskren A. Kotzev, Mustafa K. Celen Background & Aims: GS-9620, an oral agonist of toll-like receptor 7 (TLR7), is in phase 2 trials for the treatment of chronic hepatitis B (CHB). Infrequent dosing of GS-9620 (e.g. once a week) induced prolonged suppression of serum viral DNA and antigens in animal models of CHB. Here we investigated the molecular mechanisms that contribute to the antiviral response to GS-9620 by evaluating the antiviral activity of TLR7 agonists in vitro. Methods: Primary human hepatocytes (PHH) were infected with

HBV and ≥3 days later were treated with a TLR7 agonist (compound A), with media from human PBMCs treated with the TLR7 agonist (TLR7 check conditioned media; TLR7-CM) or with recombinant cytokines. Antiviral activity was evaluated by quantifying extracellular HBV DNA (qPCR), HBeAg and HBsAg (ELISA), as well as intracellular HBV RNA (qRT-PCR). Results: The TLR7 agonist compound A (a close analog of GS-9620), had no direct antiviral activity in HBV-infected PHH, consistent with the lack of functional TLR7 in hepatocytes. In contrast, sustained exposure of HBV-infected PHH to TLR7-CM strongly reduced the levels of HBV DNA and HBeAg (>90%), as well as HBsAg and HBV RNA (>75%), without detectable toxicity. Reductions in viral parameters were observed when PHH were treated with TLR7-CM early (3 days) or late (13 days) post-infection, but were not induced by media from control DMSO-treated PBMCs. We next compared the durability of short (3 day) and long (10 day) treatment of HBV-infected PHH with TLR7-CM. Short duration treatment (days 3-6 post-infection) only transiently reduced HBeAg.

97 The similar mechanisms of diet-induced and alcohol-induced steatosis, together with ethanol’s ability to increase endocannabinoid levels, at least in the brain,98 suggest ECS involvement

in the alcoholic fatty liver. Indeed, the exposure of male mice click here to a low-fat, liquid ethanol diet for 4 weeks increased hepatic CB1 expression and 2-AG levels but not AEA levels. 2-AG was increased in HSCs but not in hepatocytes. The expression of diacylglycerol lipase β was also increased in HSCs,23 and this suggests increased biosynthesis of 2-AG. Rimonabant treatment attenuated ethanol-induced steatosis without affecting alcohol intake and blood ethanol levels, and this suggests CB1 involvement. This was further supported by the resistance of both CB1−/− and LCB1−/− ACP-196 solubility dmso mice to ethanol-induced steatosis.23 The hepatic nuclear expression of SREBP1c and its target FAS was increased, whereas CPT1 expression and activity decreased in ethanol-fed mice, in agreement with earlier findings.96 In both CB1−/− and LCB1−/−

mice, the effects of ethanol on SREBP1c, FAS, and CPT1 were blunted or absent. Furthermore, CPT1 activity was increased and resistant to suppression by ethanol in both CB1 knockout strains.23 This supports the notion that in alcoholic fatty liver disease (AFLD), hepatic lipogenesis is increased and fatty acid oxidation is decreased via CB1 activation. CB1−/− hepatocytes are resistant to ethanol-induced steatosis, whereas ethanol increases 2-AG exclusively in HSCs. This suggests a paracrine mechanism by which HSC-derived 2-AG activates CB1 receptors on adjacent hepatocytes to stimulate lipogenesis and inhibit fatty acid oxidation in the latter. Indeed, coculturing HSCs from alcohol-fed mice with hepatocytes from control mice resulted in increased lipogenic gene expression in the latter. The paracrine effect of ethanol-primed HSCs was blunted when the hepatocytes in the coculture were from LCB1−/− mice, and this confirmed the role of CB1 receptors.23 This paracrine interaction, together with high levels of retinoic acid in HSCs and its well-known role

in the control of gene expression, prompted a study of the possible role of retinoic acid and its receptors in regulating hepatic CB1 expression. CB1 expression in isolated mouse or human hepatocytes was up-regulated by retinoid Selleck Gefitinib A receptor γ (RARγ) or pan-RAR agonists, and the effect could be attenuated by small interfering RNA knockdown of RARγ but not other RAR subtypes.25 Both CB1 and RARγ were up-regulated in hepatocytes from mice fed either a high-fat diet or a liquid alcohol diet. Furthermore, 2-AG up-regulated CB1 in normal hepatocytes but not in retinaldehyde dehydrogenase 1−/− hepatocytes, which are deficient in retinoic acid. Thus, CB1 autoinduction may also involve retinoic acid.25 Interestingly, autoinduction of hepatic CB1 receptors is also suggested by the finding that chronic rimonabant treatment of DIO mice reversed the diet-induced up-regulation of hepatic CB1.

There is a paucity of local data regarding the epidemiology of HCV genotype in a multi-ethnic society like Malaysia. Methods: This is a cross-sectional prospective study conducted from 2008 till 2012. Patients who were detected to have HCV antibodies were included and tested for the presence of HCV RNA using Cobas Amplicor Analyzer (Roche Diagnostic).

Genotyping was then carried out using single Liner Array HCV Genotyping Strip MLN8237 mw (Roche Diagnostic). Results: Our result showed that HCV genotype 3 is the most predominant genotype here (61.7%) followed by genotype 1 (36.0%), genotype 2 (1.7%) and genotype 6 (0.6%) as shown in table 1. Our result is different from the early study by Greene et al where the predominant genotype was genotype 1. It is also interesting to note that the distribution of different genotypes were rather similar Kinase Inhibitor Library nmr across all the major ethnic races. Conclusion: In conclusion, genotype 3 is the predominant HCV genotype and there are no

significant ethnic differences in the distribution of the HCV genotypes in Malaysia. Key Word(s): 1. Hepatitis C; 2. Genotype; 3. Predominant; 4. Malaysia; Table 1 Ethnic group HCV genotype (%) Total (% across all the ethnic races) 1 2 3 6 Malay(% within genotype \ ethnic) 48 (37.2%\33.1%) 1 (16.7%\0.7%) 96 (43.4%\66 2%) 0 145 (40.5%) Chinese (S within genotype \ ethnic) 53 (41.1%\37.3%) (66.6%\28%) 83 (37.6%\58.S%) 2 (100%\1.4%) 142 (39.7%) Indian (% within genotype \ ethnic) 19 (14.7%\36.5%) 1 (16.7%\1.9%) 32 (14.5%\61.6%) 0 52 PTK6 (145%) Others (% within genotype \ ethnic) 9 (7.0%\47.4%) 0 10 (4.5%\52.6%) 0 19 (5.3%) Total (% across all the genotypes) 129 (36.0%) 6 (1.7%) 221 (61.7%) 2 (0.6%) 358 Presenting Author: YAN XU Additional Authors: YONGGUI ZHANG, JIAN JIAO, CHANGYU ZHOU, PING ZHAO, HONGHUA GUO, YAN LI, SHANGWEI JI, JIANGBIN

WANG Corresponding Author: YAN XU Affiliations: china-japan union hospital of jilin university Objective: To investigate the efficacy of individualized therapy with PEG-IFNα-2a and the effect of antiviral therapy on hepatic histology in chronic hepatitis B patients. Methods: 178 antiviral-naïve hepatitis B patients received subcutaneous Peg-IFNα-2a treatment (180 μg weekly) with an individualized regimen based on response at 12 weeks. Subjects not achieving early response received nucleoside combination therapy, or 48-week treatment; 38 subjects underwent hepatic histological examinations before and after treatment. Results: With combination treatment (entecavir or adefovir), mean hepatitis B virus (HBV) DNA reduction at 48 weeks of post-treatment follow-up was significantly greater than with conventional treatment; the SVR rate was significantly higher with entecavir (69.4%) and adefovir (71.1%) than with conventional treatment (32.6%, p < 0.05).