PCR-based detection of HP0986 was performed on all H. pylori strains using gene-specific primers as described elsewhere [14]. Helicobacter pylori cultures (n = 110) were pelleted

and washed twice with 1X phosphate buffer saline and further pelleted by centrifugation at 4000 rpm for 5 minutes RNA was extracted from each pellet using Qiagen RNeasy Mini Kit as per the manufacturer’s instructions and treated with DNase I (Qiagen, Hilden, Germany) on columns and further purified by RNA clean up. In a similar way, total RNA from each of the 10 frozen biopsies were Enzalutamide mouse also extracted. RNA samples were quantitated by Nanodrop spectrophotometer and stored at −80°C until further use. Expression analysis was carried out by IQ5 real-time PCR (BioRad Laboratories, Hercules, CA, USA). Briefly, the reaction was performed in 25 μL volume containing 12.5 μL of SYBR green (iScript™One-Step RT-PCR kit, Qiagen), 1.25 μL of forward primer GAAAAGAGTTTA GAAAAGATACA, 1.25 μL of reverse primer CTTGAT GGTCTTTGTAAAACA, 0.25 μL of reverse transcriptase (Qiagen), 1 μL of RNA template, and 8.75 μL of Dnase/RNase free water. PCR conditions for both HP0986 and 16S RNA (control) were denaturation at 94°C for 15 minutes; 40

cycles of 94°C for 15 seconds; annealing at 45°C for 30 seconds, extension at 72°C for 30 seconds followed by 61 cycles Dorsomorphin of melting curve analysis at 65°C for 10 seconds. Reaction without RNA template was included as negative control for each primer tested and a control without reverse transcriptase was also included for each test. The analysis was performed in triplicates and IQ5 real-time PCR software (Biorad) was used to generate the quality control of the replicates, data extraction and initial analysis. Data were analyzed by ∆∆CT method as described earlier

[23]. Relative expression level of HP0986 normalized to the 16SrRNA was checked in clinical isolates and in gastric biopsies when compared with the Vasopressin Receptor levels of HP0986 mRNA in strain P12. Also, HP0986 specific amplification was confirmed by a single amplicon on 1% agarose gel. The ORF/gene hp0986 was cloned in prokaryotic expression vector pRSETA and was purified to homogeneity as described earlier [21]. To clone hp0986 into eukaryotic expression vector, the gene was amplified from the genomic DNA of H. pylori strain 26,695 using the following primers: 5′CCCCTCGAGATGGTGGAACT TTTTTCTCTTTGCATGTC 3′ (xho I), 5′AATAAGCTTACG CCTAGAGTTATTAATATAATTCTCAATATTTT 3′ (Hind III). The amplified 714 bp product and TA cloning vector (Fermantas, Lafayette, CO, USA) were incubated together for an overnight ligation at 16°C. Insert was confirmed by double restriction digestion (Hind III, xho I) and was further subcloned into pEGFPN-1 (Clonetech) vector. The clone was again confirmed for the insert by double restriction digestion and sequencing. AGS cells were obtained from the National Center for Cell Sciences, (Pune, India).