, 2008). ShRNA-resistant Syt1 was made by mutating the Syt1 sequence 5′–GAGCAAATCCAGAAAGTGCAA−3′ into 5′–GAACAGATTCAAAAGGTCCAA−3′. Three AAV vectors were constructed. In control vector, the following components were arranged sequentially downstream of left-ITR of AAV2: CMV promoter and beta-globin intron, EGFP, hGH poly A sequence, H1 promoter,

SV40 poly A sequence, and right ITR. In Syt1 KD AAV vector, Syt1 short hairpin sequence was cloned into the Xho1-Xba1 locus downstream of H1 promoter of control vector. In TetTox vector, the following check details components were arranged sequentially downstream of the left-ITR: CMV promoter and beta-globin intron, EGFP, and TetTox linked in frame by 2A sequence as described above, hGH poly A, and the right ITR. Lentivirus and cortical culture were prepared and recorded as described (Maximov et al., 2007 and Pang et al., 2010). Neurons derived from postnatal day 0 (P0) or P1 mice were infected with lentivirus

at 5–6 days in vitro (DIV) and recorded at 15–16 DIV. Cultured neurons were transferred to extracellular solution containing (at room temperature with pH 7.4) 140 mM NaCl, 5 mM PARP inhibitor KCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM HEPES, and 10 mM glucose. The neurons were patched with pipettes with resistance between 3 and 4 MΩ and clamped at −70mV. The patch pipette was filled with intracellular solution containing the following components (at room temperature with pH 7.4): 135 mM CsCl, 10 mM HEPES, 1 mM EGTA, 1 mM Na-GTP, 4 mM Mg-ATP, and 10 mM QX-314 [N-(2,6-dimethylphenylcarbamoylmethyl) triethylammonium bromide]. Synaptic current was evoked by 90 μA/1 ms current injections via concentric bipolar electrode (CBAEC75,

FHC) placed ∼150 μm to the patched neurons. IPSCs were isolated by adding AMPA and NMDA receptor blockers CNQX (20 μM) and AP-5 (50 μM) in the extracellular solution. The frequency, duration, and magnitude of the extracellular stimulus were controlled with a model 2100 Isolated Pulse Stimulator (A-M Systems) synchronized with Clampex 10.2 data acquisition software (Molecular Devices). Synaptic currents were monitored with a Multiclamp 700B amplifier (Molecular Devices). Synaptic currents were sampled at 10 kHz and analyzed offline using Clampfit Linifanib (ABT-869) 10.2 (Molecular Devices) software. For graphic representation, the stimulus artifacts of the current traces were removed. AAVs were packaged with AAV-DJ capsids for high-efficiency in vivo neuronal infection. Virus was prepared with a procedure as described (Zolotukhin et al., 1999). Briefly, AAV vectors were cotransfected with pHelper and pRC-DJ into AAV-293 cells. Cells were collected 72 hr later, lysed, and loaded onto iodixanol gradient for centrifugation at 400,000 g for 2 hr. The fraction with 40% iodixanol of the gradient was collected, washed, and concentrated with 100,000 MWCO tube filter. The infectious titer of virus was measured by infecting HEK293 cells. The concentrations of virus used for stereotaxic injection were adjusted to 1.