The present project is in compliance with the Helsinki Declaration (Ethical Principles for Medical Research Involving Human Subjects). Strains were collected from sputum specimen as part of the patients’ usual care, without any

additional sampling. All patient data shown in the present work were anonymously reported, without offering any possibility to trace the actual patients. The “”Comité Consultatif pour la Protection des Personnes dans la Recherche Biomédicale (CCPPRB) GSK2399872A nmr Ile-De-France – Paris – Saint Antoine”" was consulted on April 4th 2006 and allowed the exemption of patient’s written informed consent. Microbiology Sputum samples were inoculated onto sheep blood, chocolate and salt mannitol agar (bioMérieux, France). After 2 days of incubation at 35°C, non identical-looking

colonies were picked and tested for Gram stain and catalase reaction. Identification of S. aureus species was confirmed with the Pastorex Staph-Plus® slide test (Bio-Rad, France), and antimicrobial susceptibility performed by disk diffusion. Methicillin (oxacillin) Pexidartinib solubility dmso resistance was screened with the cefoxitin disk diffusion method, and the PBP 2a was detected with the MRSA-screen latex agglutination test (Denka, Seiken Co, Ltd, Japan) [34]. For MRSA isolates showing a negative PBP 2a agglutination test, overproduction of β-lactamase was screened looking for irregular aspect of the inhibition zone around the oxacillin disk, combined with a synergistic aspect between the inhibition zones of oxacillin and amoxicillin+clavulanate disks. The isolates with overproduction of β-lactamase are named BOR-SA (borderline S. aureus). In addition, detection of PBP 2a was performed in every MSSA isolates recovered from patients known to be previously colonized with MRSA. mecA gene detection The presence of the mecA gene was searched by PCR amplification in all the isolates. Primers MecA_F, AAAATCGATGGTAAAGGTTGGC and MecA_R, AGTTCTGCAGTACCGGATTTGC were as described by Murakami et al. [35]. DNA purification About 20 colonies from a subculture on solid media were dissociated in 180 μl TE buffer (Tris 10 mM, EDTA 1 mM pH8). Then 20 Selleckchem Fludarabine μl

of Lysostaphin (AMBICIN® L, AMBI PRODUCTS LLC, Lawrence, USA) at a concentration of 1 mg/ml was added, the mixture was vortexed and incubated for 30 minutes at 37°C. One μl of Proteinase K (20 mg/ml) and 200 μl 2 × lysis Buffer (1% de SDS, 20 mM Nacl, 20 mM Tris pH8, 20 mM EDTA) were added, and the samples were incubated 30 minutes at 50°C. DNA was purified using phenol extraction and precipitation with ethanol. The quality and concentration of DNA was measured using a ND-1000 Spectrophotometer (NanoDrop®, Labtech, Palaiseau, France). The DNA was diluted at 1 ng/μl in water for the PCR amplification reaction. Genotyping The MLVA-14 scheme is described in detail elsewhere [21], as well as its performance as compared to MLST and spa typing.